99
|
Oxford Instruments
resource source identifier software Resource Source Identifier Software, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/resource source identifier software/product/Oxford Instruments Average 99 stars, based on 1 article reviews
resource source identifier software - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
prime 9.0.0 Prime 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prime 9.0.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prime 9.0.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
prims version 9.0.0 for windows Prims Version 9.0.0 For Windows, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prims version 9.0.0 for windows/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prims version 9.0.0 for windows - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
graph pad prim version 9.0.0 Graph Pad Prim Version 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graph pad prim version 9.0.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graph pad prim version 9.0.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
prims version 9.00 Prims Version 9.00, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prims version 9.00/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prims version 9.00 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
graphpad prime (9.0.0) Graphpad Prime (9.0.0), supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad prime (9.0.0)/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad prime (9.0.0) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
prism version 9.0.0 Prism Version 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prism version 9.0.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prism version 9.0.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
prims version 9.0.0 Prims Version 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prims version 9.0.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prims version 9.0.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
graphpad prim 9.0.0 Graphpad Prim 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad prim 9.0.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad prim 9.0.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
prims 9 – version 9.0.0 Prims 9 – Version 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prims 9 – version 9.0.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prims 9 – version 9.0.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
graphpad prism 9.0.0 Graphpad Prism 9.0.0, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad prism 9.0.0/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad prism 9.0.0 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
prism7  Prism7, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prism7/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
prism7 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell reports
Article Title: Striatal Projection Neurons Require Huntingtin for Synaptic Connectivity and Survival
doi: 10.1016/j.celrep.2019.12.069
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: MGI: 2177755 Oligonucleotides Htt Forward Primer: CAGGTCCGGCAGAGGAAC This Paper N/A Htt Reverse Primer: CATAGCGATGCCCAAGAGTT This Paper N/A pENK Forward Primer: GTTGTCTCCCGTTCCCAGTA This Paper N/A pENK Reverse Primer: GACAGCAGCAAACAGGATGA This Paper N/A Tac1 Forward Primer: TCGATGCCAACGATGATCTA This Paper N/A Tac1 Reverse Primer: AGCCTTTAACAGGGCCACTT This Paper N/A DARPP-32 Forward Primer: CCCAAAGTCGAAGAGACCCA This Paper N/A DARPP-32 Reverse Primer: CCGAAGCTCCCCTAACTCATC This Paper N/A Software and Algorithms Statistica StatSoft http://www.statsoft.com/Produ cts/STATISTICA-Features
Techniques: Isolation, Reverse Transcription, Software